Web Shop and Prices

References

Technical information




Application notes

Strep-tag

One-STrEP-tag

MATra

Oligos

Fab Streptamers

FAQ´s and Trouble shooting

Manuals


Newsletters & Flyers

Price List: Nucleic Acids

  • IBA oligonucleotide price list 2011! EUR (PDF, 71 KB), US$ (PDF, 72 KB)
Prices for other product lines on request at info@iba-go.com

Order Forms

Software (Cloning / Primer)

Classic cloning:

Download the new version of our free software for the fast design of PCR primers for cloning genes with pASK-IBA and pPR-IBA vectors

StarGate cloning:

Make use of the easy-to-use software, the StarPrimer D´Signer 3.0.0.3, to facilitate the design of primers for the ENTRY cloning step to create the Donor Vector.
The software is also very well suited for the design of primers in combination with a site-directed mutation approach. In this case it is used to design primers for introducing mutations into your gene of interest which then is transferred into a StarGate ENTRY vector to create a Donor Vector carrying the mutated gene of interest.
This software does not only help with the primer design, it will also guide you step by step through the whole PCR process.

Vector MAPS

Classic Vectors:

pASK-IBA (E. coli with Tet promoter)

pPR-IBA (E. coli with T7 promoter)

pEXPR-IBA (mammalia with CMV promoter)

pKS-ST (yeast with ADH2 promoter)

StarGate Vectors:

StarGate ENTRY Vectors

StarGate Acceptor Vectors:

pASG-IBA Vectors (E. coli with Tet promoter)

pCSG-IBA Vectors (Mammalian episomal vectors)

pESG-IBA Vectors (Mammalian cells with CMV promoter)

pLSG-IBA Vectors (Insect cells (baculovirus) with polyhedrin promoter

pPSG-IBA Vectors (E. coli with T7 promoter)

pYSG-IBA Vectors (Yeast with CUP1 promoter)

StarGate Fusion Vectors

pNFuse-IBA Vectors

pCFuse-IBA Vector

Vector Sequences

Classic Vectors (txt):

pASK-IBA Vectors (E. coli with Tet promoter)

pPR-IBA Vectors (E. coli with T7 promoter)

pEXPR-IBA Vectors (mammalia with CMV promoter)

pKS –ST Vectors (yeast with ADH2 promoter)

StarGate Vectors (txt):

StarGate ENTRY Vectors

StarGate Acceptor Vectors:

pASG-IBA Vectors

pCSG-IBA Vectors

pESG-IBA Vectors

pLSG-IBA Vectors

pPSG-IBA Vectors

pYSG-IBA Vectors

Fusion Cloning Vectors:

pNFuse-IBA Vectors

pCFuse-IBA Vector

StarGate Acceptor Vector List

Comprehensive list of StarGate Acceptor Vectors

Technical Information

Gene TAGnologies

Molecular weight and extinction coefficients of synthetic oligonucleotides
- Calculate the molecular weight of DNA as follows:

Mol. wt = [(251 x nA) + (242 x nT) + (267 x nG) + (227 x nC) + (63 x n - 1) +
(23 x n - 1) + 2]

nA = number of adenine bases in the DNA sequence and n = total number of bases.

(63 x n - 1) accounts for the molecular weight of the phosphate groups. For phosphorothioates this is (78 x n - 1)
(23 x n - 1) accounts for the sodium cations associated with the phosphate groups. If the DNA is an ammonium salt this is (17 x n - 1).

Example:
The 20mer d(AGCTCTGAACGTAGCTCTGA)

Mol. wt =

[(5 x 251) + (5 x 242) + (5 x 267) + (5 x 227) + (63 x 19) +
(23 x 19) + 2] = 6571 mg/mmol


- Calculation of millimolar extinction coefficient (E254):

E254 = [(8.8 x nT) + (7.3 x nC) + (11.7 x nG) + (15.4 x nA)] x 0.9*

For the 20mer d(AGCTCTGAACGTAGCTCTGA):

E254 = [(8.8 x 5) + (7.3 x 5) + (11.7 x 5) + (15.4 x 5)] x 0.9* = 194.4 mM-1cm-1

*Note that it is advisable to multiply the sum of the extinction coefficient of the individual bases by a factor of 0.9. This is because base stacking interactions in the single strand suppress the absorbance of DNA relative to the value calculated from the extinction coefficients of the individual nucleosides. This effect is greater for a duplex and the multiplication factor for a selfcomplementary sequence is c. 0.8. These figures are estimates for typical DNA sequences.


- To convert OD units to milligrams

From the above calculations, 6.6 mg of the oligonucleotide
d (AGCTCTGAACGTAG CTCTGA) dissolved in 1 ml will have an absorbance of approximately 194.4 OD units at 254 nm.

6.6 mg = 194.4 OD units. Therfore, 1 mg = 29 OD


Protein/DNA conversion

1kb of DNA encodes 333 amino acids = 3.7 x 104 DA

 Molecular conversion for protein
Protein DNA 100 pmol µg
10,000 Da 270.0 bp 10,000 Da protein 1
30,000 Da 810.0 bp 30,000 Da protein 3
100,000 Da 2.7 kb 100,000 Da protein 10


Melting temperature of duplex DNA and oligonucleotides

- For duplex oligonucleotide shorter than 25 bp

Tm = 2(A+T) + 4(C+G)
A, T, C, G - number of respective bases

- For duplex DNA longer than 25 bp

Tm = 81.5°C + (16.6log10[Na+])+0.41 x (G+C)%-600/n
n=length of oligonucleotide


The genetic code



Nucleotide ambiguity code

Code Represents Complement
A A T
C C G
G G C
T T A
M A or C K
R A or G Y
W A or T W
S C or G S
Y C or T R
K G or T M
V A or C or G B
H A or C or T D
D A or G or T H
B C or G or T V
X/N A or C or G or T X/N

not A, C, G or T -

Protein TAGnologies

Converting from linear flow (cm/hour) to volumetric flow rates (ml/min) and vice versa

It is convenient when comparing results for columns of different sizes to express flow as linear flow (cm/hour). However, flow is usually measured in volumetric flow rate (ml/min). To convert between linear and volumetric flow rate use one of the formulae below.

From linear flow rate (cm/hour) to volumetric flow rate (ml/min)

Volumetric flow rate (ml/min) = Linear flow rate (cm/h) x column cross sectional area (cm2)
60

= LFR x p x d2
60 4

where
LFR = linear flow rate in cm/h
d = inner diameter of the column in cm


Example:

What is the recommended volumetric flow rate in a Ready-to-use Strep-Tactin POROS column (i.d. 0.46 cm) when the recommended linear flow rate is 700 cm/hour?
LFR = 700 cm/h
d = 0.46 cm


Volumetric flow rate (ml/min) = 700 x p x 0.462 = 1.94 ml/min
60 4


From volumetric flow rate (ml/min) to linear flow rate (cm/hour)

Linear flow rate (cm/h) = Volumetic flow rate (ml/min) x 60
column cross sectional area (cm2)

= VFR x 60 x 4
p x d2

where
VFR = volumetric flow rate in cm/h
d = inner diameter of the column in cm


Example:

What is the recommended linear flow rate in a Ready-to-use MacroPrep Cartridge (i.d. 0.59 cm) when the recommended volumetric flow rate is 1.5 ml/min?
VFR = 1.5 ml/min
d = 0.59 cm

Linear flow rate (cm/h) = 1.5 x 60 x 4 = 329 cm/h
p x 0.592

 

how to order search download contact